ID: 1084519600_1084519615

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1084519600 1084519615
Species Human (GRCh38) Human (GRCh38)
Location 11:69655389-69655411 11:69655429-69655451
Sequence CCTGCTGTCTACCCTTCCTGCCT AGGGCTCAACAGTGGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 620} {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!