ID: 1084519653_1084519662

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1084519653 1084519662
Species Human (GRCh38) Human (GRCh38)
Location 11:69655547-69655569 11:69655582-69655604
Sequence CCTGAGGGTGGGGGCTCCGGGAG GAGTCCTATATTGAGTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 438} {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!