ID: 1084598642_1084598651

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1084598642 1084598651
Species Human (GRCh38) Human (GRCh38)
Location 11:70132071-70132093 11:70132117-70132139
Sequence CCCTCTGGGGTAAGCAGGGCTCC GGTGAGTCTGAGTGGTACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 195} {0: 1, 1: 0, 2: 2, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!