ID: 1084606189_1084606199

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1084606189 1084606199
Species Human (GRCh38) Human (GRCh38)
Location 11:70173538-70173560 11:70173557-70173579
Sequence CCCCTCATACCACAGCCCTCCAT CCATGGCCAGAGGTGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 247} {0: 1, 1: 0, 2: 5, 3: 64, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!