ID: 1084633769_1084633776

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1084633769 1084633776
Species Human (GRCh38) Human (GRCh38)
Location 11:70375911-70375933 11:70375962-70375984
Sequence CCATCCATTGACTCCACATTAGA CAATGTAGTCATAGCAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154} {0: 1, 1: 1, 2: 1, 3: 17, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!