ID: 1084683633_1084683641

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1084683633 1084683641
Species Human (GRCh38) Human (GRCh38)
Location 11:70681188-70681210 11:70681218-70681240
Sequence CCAAGTCCCCCGTTCTCTCTCTG GCGTGGGGTCCCTTTTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 324} {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!