ID: 1084704180_1084704187

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1084704180 1084704187
Species Human (GRCh38) Human (GRCh38)
Location 11:70806371-70806393 11:70806412-70806434
Sequence CCAACTTCCCTCCAACCCTACTT TCACACACCTGACTTCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 1005} {0: 1, 1: 0, 2: 0, 3: 14, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!