ID: 1084745366_1084745372

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1084745366 1084745372
Species Human (GRCh38) Human (GRCh38)
Location 11:71166771-71166793 11:71166816-71166838
Sequence CCACACCGGGCCCACACTTCTTT TTCTTGGGTGTTTCTCGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 138, 4: 988} {0: 970, 1: 1150, 2: 357, 3: 202, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!