ID: 1084788576_1084788588

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084788576 1084788588
Species Human (GRCh38) Human (GRCh38)
Location 11:71458693-71458715 11:71458731-71458753
Sequence CCTATCTCAGCCCCGTAAGCCAC AGGAGGGAGCTCCTGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 240} {0: 1, 1: 0, 2: 1, 3: 32, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!