ID: 1084810254_1084810265

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1084810254 1084810265
Species Human (GRCh38) Human (GRCh38)
Location 11:71607611-71607633 11:71607644-71607666
Sequence CCACGGACTCAGCCTCCCTCCTC GTTTACCACTTCTTAGGTCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 2, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!