|
Left Crispr |
Right Crispr |
| Crispr ID |
1084847270 |
1084847277 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:71910547-71910569
|
11:71910565-71910587
|
| Sequence |
CCTTCTGCTGGGACACCCCACGG |
CACGGCATTCGGGTGTGCCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 25, 1: 18, 2: 30, 3: 28, 4: 133} |
{0: 3, 1: 23, 2: 15, 3: 21, 4: 49} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|