ID: 1084949708_1084949722

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1084949708 1084949722
Species Human (GRCh38) Human (GRCh38)
Location 11:72657912-72657934 11:72657953-72657975
Sequence CCACCCAGCCTCTGTGAGCAGGG ATGTCACAGGAGCTGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 52, 4: 375} {0: 1, 1: 0, 2: 3, 3: 46, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!