ID: 1084950126_1084950134

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1084950126 1084950134
Species Human (GRCh38) Human (GRCh38)
Location 11:72660325-72660347 11:72660375-72660397
Sequence CCATGCAGAAACTAAGGAGGGGC ATATTAGGTGCTCACACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161} {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!