ID: 1084969507_1084969510

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1084969507 1084969510
Species Human (GRCh38) Human (GRCh38)
Location 11:72762981-72763003 11:72763021-72763043
Sequence CCAGGAAGTAAGCAAATACTCAA GGACACCGGAACCAGCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 88, 4: 527} {0: 1, 1: 3, 2: 17, 3: 70, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!