ID: 1084982453_1084982458

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1084982453 1084982458
Species Human (GRCh38) Human (GRCh38)
Location 11:72837726-72837748 11:72837744-72837766
Sequence CCACGAGCCACCAGGTTCTTCCT TTCCTTCCACGGAAATGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 147} {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!