ID: 1085011013_1085011022

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1085011013 1085011022
Species Human (GRCh38) Human (GRCh38)
Location 11:73141925-73141947 11:73141966-73141988
Sequence CCAGGAGGAGGAGGAGGGCCGGA CGAGCGCGCGCGTGTGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 679} {0: 1, 1: 0, 2: 2, 3: 19, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!