ID: 1085054131_1085054141

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1085054131 1085054141
Species Human (GRCh38) Human (GRCh38)
Location 11:73394300-73394322 11:73394323-73394345
Sequence CCACAGGCCTGTGTCCAAGTGAG TGGGCTGGTGGGAGATAACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 234} {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!