ID: 1085083623_1085083634

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1085083623 1085083634
Species Human (GRCh38) Human (GRCh38)
Location 11:73652549-73652571 11:73652579-73652601
Sequence CCAACAAAGGCCCCATTGTCCCG TGGGCCTTCCTGAGGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81} {0: 1, 1: 2, 2: 8, 3: 61, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!