ID: 1085084316_1085084327

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085084316 1085084327
Species Human (GRCh38) Human (GRCh38)
Location 11:73656611-73656633 11:73656642-73656664
Sequence CCTGAATCTTTTCTCTGTCCCCA CACAGGGCCTGGCATGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 480} {0: 1, 1: 3, 2: 64, 3: 644, 4: 2714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!