ID: 1085120700_1085120711

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1085120700 1085120711
Species Human (GRCh38) Human (GRCh38)
Location 11:73965604-73965626 11:73965646-73965668
Sequence CCATGCTTTCCACAGATGGAACC GGAGTGGAAGGATCCCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 248} {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!