|
Left Crispr |
Right Crispr |
| Crispr ID |
1085178532 |
1085178538 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:74511699-74511721
|
11:74511740-74511762
|
| Sequence |
CCACCCTGAAGGGGAGGACACAA |
CCTGTTAATTGTAGAGCCCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 26, 2: 109, 3: 210, 4: 373} |
{0: 2, 1: 11, 2: 124, 3: 444, 4: 789} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|