ID: 1085186449_1085186460

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1085186449 1085186460
Species Human (GRCh38) Human (GRCh38)
Location 11:74579912-74579934 11:74579964-74579986
Sequence CCAATAAATATTTGCTAAGGGCC GCTGGGAACCAGGGATGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 293} {0: 1, 1: 0, 2: 4, 3: 37, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!