ID: 1085194851_1085194864

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1085194851 1085194864
Species Human (GRCh38) Human (GRCh38)
Location 11:74662957-74662979 11:74663001-74663023
Sequence CCCACAGTTGCTGCACTCTCCCT TGTACCAAGGGCACTGCAAGGGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 28, 3: 85, 4: 328} {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!