ID: 1085283418_1085283439

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1085283418 1085283439
Species Human (GRCh38) Human (GRCh38)
Location 11:75345258-75345280 11:75345309-75345331
Sequence CCCAGGAAGGAGGAGGCGCGTCT TAGGGAAGGCGGGAGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117} {0: 1, 1: 0, 2: 7, 3: 122, 4: 1315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!