ID: 1085283721_1085283727

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1085283721 1085283727
Species Human (GRCh38) Human (GRCh38)
Location 11:75346714-75346736 11:75346731-75346753
Sequence CCCTCTTCTCTCCATACCCAGGC CCAGGCACTGGTGCTCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 91, 4: 554} {0: 1, 1: 0, 2: 1, 3: 24, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!