ID: 1085296946_1085296951

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1085296946 1085296951
Species Human (GRCh38) Human (GRCh38)
Location 11:75436675-75436697 11:75436688-75436710
Sequence CCCACCAACCATGGCACTGACAC GCACTGACACCAAGCCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 127} {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!