ID: 1085305325_1085305331

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1085305325 1085305331
Species Human (GRCh38) Human (GRCh38)
Location 11:75482517-75482539 11:75482535-75482557
Sequence CCCTTTTCTCGCCATCCCCACAG CACAGCCACTCCCCTGTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 468} {0: 1, 1: 0, 2: 2, 3: 16, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!