ID: 1085306240_1085306251

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1085306240 1085306251
Species Human (GRCh38) Human (GRCh38)
Location 11:75487615-75487637 11:75487652-75487674
Sequence CCAACACTTCTGTCCCAAGAGAC CCTCTCGGGAGGAGGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 198} {0: 1, 1: 0, 2: 1, 3: 38, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!