ID: 1085307011_1085307027

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1085307011 1085307027
Species Human (GRCh38) Human (GRCh38)
Location 11:75492231-75492253 11:75492274-75492296
Sequence CCTGCCATTCCCCTCCTCCTACC CTGTGTCAGGTCACCCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 997} {0: 1, 1: 0, 2: 3, 3: 28, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!