ID: 1085309637_1085309652

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085309637 1085309652
Species Human (GRCh38) Human (GRCh38)
Location 11:75508682-75508704 11:75508720-75508742
Sequence CCTCCCCCACTGTGGCCCCCATG GGAGGATCTGTGATGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 446} {0: 1, 1: 0, 2: 1, 3: 19, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!