ID: 1085319784_1085319789

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1085319784 1085319789
Species Human (GRCh38) Human (GRCh38)
Location 11:75566891-75566913 11:75566913-75566935
Sequence CCGACGGCAAGCTGCCCGAGGTC CACCAAGGACGTGGAGCGCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 70} {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!