ID: 1085320192_1085320207

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1085320192 1085320207
Species Human (GRCh38) Human (GRCh38)
Location 11:75569235-75569257 11:75569284-75569306
Sequence CCACTCACCAATTCAGCAGGTCT CAGTGCTGGGCTCTGTGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150} {0: 1, 1: 0, 2: 4, 3: 57, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!