ID: 1085326667_1085326668

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1085326667 1085326668
Species Human (GRCh38) Human (GRCh38)
Location 11:75611442-75611464 11:75611462-75611484
Sequence CCTGTGGGAAAGTTTGGTAACTC CTCCTGATCTTGAACAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69} {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!