ID: 1085328533_1085328538

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1085328533 1085328538
Species Human (GRCh38) Human (GRCh38)
Location 11:75627464-75627486 11:75627497-75627519
Sequence CCATGTCTGTATGTGTCTTTGTG CTGGCCAAACAGTAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 193, 4: 3056} {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!