ID: 1085339522_1085339526

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1085339522 1085339526
Species Human (GRCh38) Human (GRCh38)
Location 11:75722136-75722158 11:75722157-75722179
Sequence CCTGCAGGGCCCACTCCTGGGTC TCTTGTCAGCAAAGAAACTTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 32, 4: 368} {0: 1, 1: 0, 2: 0, 3: 28, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!