ID: 1085345782_1085345792

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1085345782 1085345792
Species Human (GRCh38) Human (GRCh38)
Location 11:75767518-75767540 11:75767552-75767574
Sequence CCCACTGCCCTCCTGACCTACAG CATTTCCCATACCATGGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 316} {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!