ID: 1085346170_1085346186

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1085346170 1085346186
Species Human (GRCh38) Human (GRCh38)
Location 11:75769305-75769327 11:75769356-75769378
Sequence CCACCCACCATTCTTAGTTATTA CCACTGCGGCTGGTGACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!