ID: 1085462381_1085462397

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1085462381 1085462397
Species Human (GRCh38) Human (GRCh38)
Location 11:76701978-76702000 11:76702019-76702041
Sequence CCCCTAGACCCCCTGGATCAGAA TTGGAAGGTCCCCACAGCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!