ID: 1085499993_1085499997

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1085499993 1085499997
Species Human (GRCh38) Human (GRCh38)
Location 11:77011448-77011470 11:77011463-77011485
Sequence CCTGGCCCACACTGCCAGAAGCC CAGAAGCCTTCACTGTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 326} {0: 1, 1: 0, 2: 0, 3: 20, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!