ID: 1085505028_1085505031 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1085505028 | 1085505031 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:77053510-77053532 | 11:77053533-77053555 |
| Sequence | CCTGCTGGGCTGCATCCACAGGA | GCTTAGGCATTCTCAGTCACAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 7, 2: 94, 3: 433, 4: 719} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||