ID: 1085521364_1085521375

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1085521364 1085521375
Species Human (GRCh38) Human (GRCh38)
Location 11:77140676-77140698 11:77140724-77140746
Sequence CCCAGGGTCAGGGAGTGCAGCTG GATTATATGGGGCAGTTTACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 323} {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!