ID: 1085521794_1085521802

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1085521794 1085521802
Species Human (GRCh38) Human (GRCh38)
Location 11:77143497-77143519 11:77143532-77143554
Sequence CCTTGGGGAGGGAAGGAGAGGTC CCTGCCCCGGAGAAGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 412} {0: 1, 1: 0, 2: 5, 3: 21, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!