ID: 1085533847_1085533860

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1085533847 1085533860
Species Human (GRCh38) Human (GRCh38)
Location 11:77206604-77206626 11:77206644-77206666
Sequence CCTTCCTCCCTCTCCACCTGAGG ATCCAGGTCCTGTCTGCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 701} {0: 1, 1: 0, 2: 0, 3: 7, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!