ID: 1085568620_1085568623

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1085568620 1085568623
Species Human (GRCh38) Human (GRCh38)
Location 11:77539450-77539472 11:77539464-77539486
Sequence CCACAGAGAATAGCCAGTTTTAA CAGTTTTAAGAGATGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 197} {0: 1, 1: 0, 2: 3, 3: 33, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!