ID: 1085619956_1085619966

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1085619956 1085619966
Species Human (GRCh38) Human (GRCh38)
Location 11:78030605-78030627 11:78030634-78030656
Sequence CCTTCTGCCCTCCCCTCACTCAC CTGTTCTTCAGGAGACAATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 183, 4: 1299} {0: 1, 1: 0, 2: 2, 3: 22, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!