ID: 1085632688_1085632691

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1085632688 1085632691
Species Human (GRCh38) Human (GRCh38)
Location 11:78132383-78132405 11:78132402-78132424
Sequence CCTTCCTGACTCTCCTTCTGCCT GCCTCCTCCAATCATTTATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 102, 4: 1084} {0: 1, 1: 1, 2: 1, 3: 7, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!