ID: 1085639044_1085639055

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1085639044 1085639055
Species Human (GRCh38) Human (GRCh38)
Location 11:78179750-78179772 11:78179795-78179817
Sequence CCTGCCTTTGCTGTCCCTAGACC CTCTCTGCTGTCTACCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184} {0: 1, 1: 0, 2: 0, 3: 33, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!