ID: 1085640738_1085640741

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1085640738 1085640741
Species Human (GRCh38) Human (GRCh38)
Location 11:78191118-78191140 11:78191161-78191183
Sequence CCCAGGGCGTGGCAGTGGGGCTG ACACATACACACACACACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 381} {0: 23, 1: 1617, 2: 2898, 3: 4547, 4: 7775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!