ID: 1085706917_1085706919

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1085706917 1085706919
Species Human (GRCh38) Human (GRCh38)
Location 11:78794698-78794720 11:78794716-78794738
Sequence CCAGCGGAAGAGCAGAAAATGTA ATGTAGAAGGAGATTGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142} {0: 1, 1: 0, 2: 2, 3: 14, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!