ID: 1085711303_1085711313

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1085711303 1085711313
Species Human (GRCh38) Human (GRCh38)
Location 11:78831319-78831341 11:78831345-78831367
Sequence CCTAACTCCCTCTATGGCCCCAG CCAGCTCCCAGCTCCTGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 395} {0: 1, 1: 0, 2: 12, 3: 95, 4: 748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!